# paper.pdf ## Metadata - PDFFormatVersion=1.4 - IsLinearized=false - IsAcroFormPresent=false - IsXFAPresent=false - IsCollectionPresent=false - IsSignaturesPresent=false - Title=Supplemental files - Producer=macOS 版本14.8.4（版号23J319） Quartz PDFContext - Author=刘雨彤 - Creator=Word - CreationDate=D:20260616060238Z00'00' - ModDate=D:20260616060238Z00'00' ## Contents ### Page 1 TMEM187 is a novel brake-like modulator in the regulation of erythropoiesisYutong Liu1,2, Wenxin Zhang2, Jing Cai1, Di Zhou3, Hongting Zhao2#, Weichen Dong4, Biao Zhao1, Yao Lu2, Shuangying Hao2##, Yibing Ding2, Nizhen Jiang5, Tong Qiao1*, Kuanyu Li1,2,6*1State Key Laboratory of Pharmaceutical Biotechnology, Department of Vascular Surgery, Nanjing Drum Tower Hospital, Affiliated Hospital of Medical School, Nanjing University, Nanjing, 210008, P. R. China2Jiangsu Key Laboratory of Molecular Medicine, Medical School, Nanjing University, Nanjing, 210093, P. R. China3Department of Hematology, Nanjing Drum Tower Hospital, Affiliated Hospital of Medical School, Nanjing University, Nanjing, 210008, P. R. China4State Key Laboratory of Pharmaceutical Biotechnology, Department of Neurology, Nanjing Jinling Hospital, Affiliated Hospital of Medical School, Nanjing University, Nanjing, 210002, P. R. China5Jiangsu Province Blood Center, Nanjing, 210042, P. R. China6Suqian Scientific Research Institute of Nanjing University Medical School, Nanjing University, Suqian, 223800, P. R. China *To whom correspondence should be addressed: State Key Laboratory of Pharmaceutical Biotechnology & Jiangsu Key Laboratory of Molecular Medicine, Department of Vascular Surgery, Nanjing Drum Tower Hospital, Affiliated Hospital of Medical School, Nanjing University, 321 Zhongshan Road, Gulou District, Nanjing 210093, China. Email: likuanyu@nju.edu.cn; qiaotongmail@nju.edu.cn#Current address: Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, 210004, P. R. China##The Laboratory Centre for Basic Medicine Sciences, School of Basic Medical Sciences, Nanjing Medical University, Nanjing, 211166, P. R. China ### Page 2 Supplemental Methods Human primary CD34+ HSCs cultureThe cell culture procedure consisted of 2 phases. Following the isolation from human peripheral blood mononuclear cells (PBMCs) in phase I from day 0 to 5, CD34+ cells were cultured in Iscove’s Modified Dubecco’s Medium (IMDM) containing 20% FBS, 100 ng/mL recombinant human stem cell factor (SCF, cat#92251ES10, Yeasen, Shanghai, China), 50 ng/mL recombinant human thrombopoietin (TPO, cat#RP00174, ABclonal, Wuhan, China), 10 ng/mL recombinant human IL3 (cat#RP01362, ABclonal), 50 ng/mL recombinant human FLT3L (cat#RP00175, ABclonal) and 1% penicillin-streptomycin (P/S). In phase II from day 6 to day 11, TPO and FLT3L were omitted from the culture medium, and 1 U/mL recombinant human erythropoietin (EPO, cat#RP01532, ABclonal) was supplemented to induce the erythroid differentiation.Serial blood withdrawalTo induce acute anemic stress, 300 μL of peripheral blood was collected from the retro-orbital venous plexus of mice (8-10 wk old) over three consecutive days. Peripheral blood was obtained from the retro-orbital venous plexus of mice for total blood count, collected in heparinized tubes.Blood routine examinationsWhole blood was collected in heparinized tubes, and the number of red blood cells (RBC), hemoglobin concentration (HGB), mean corpuscular volume (MCV), hematocrit (HCT), white blood cells (WBC), lymphocytes (Lymph), monocytes (Mon),granulocytes (Gran), and blood platelet (PLT) were tested by a Mindray automatic hematology analyzer (BC-2800vet, Shenzhen, China).Blood biochemical examinationsBlood was collected in heparinized tubes and centrifuged at 1,200 g for 15 min at 4°C. Serum samples were prepared for the determination of serum transferrin (TF), serum iron, unsaturated iron binding capacity (UIBC), total iron binding capacity (TIBC), and transferrin saturation (TS) by the auto chemical analyzer (Beckman Coulter AU5421, CA). ### Page 3 Isolation of Ter119+ cells in bone marrowSix- to eight-week-old mice were euthanized. Following dissection of the hind legs, bone marrow (BM) was aseptically extracted from the tibia and femur after removal of the surrounding muscle. The harvested bone marrow cells were then filtered through a 70 μm cell strainer. The harvested BM cells were washed twice with 1×PBS. The cell pellet was then resuspended and stained with Elab Fluor® 647 Anti-Mouse TER-119 Antibody (cat#E- AB-F1125M, eBioscience, San Diego, CA, USA), followed by incubation at 37℃ in the dark for 30 minutes. After incubation, the cells were washed with 1×PBS to remove unbound dye. Subsequently, Ter119+ cells were isolated using Anti-Cy5/Anti-Alexa Fluor 647 MicroBeads (cat#130-091-395, Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer's instructions for subsequent experiments.Isolation of total cells in the spleenSix- to eight-week-old mice were euthanized. Following dissection, the spleen tissue was minced into small fragments and placed in a sterile culture dish with an appropriate volume of PBS buffer. The fragments were gently pressed using a syringe plunger and passed through a mesh screen to dissociate the cells. The resulting cell suspension was filtered through a 70 μm cell strainer to obtain a single-cell suspension. Subsequently, the suspension was centrifuged at 1500 rpm for 5 min, and the cell pellet was collected for use.Gene knockout and knockdown in cellsTo construct K562 TMEM187 knockout (KO) and knockdown (KD) cells, the pGK1.1 plasmids containing guide RNAs (gRNA) and pLKO.1 plasmids containingTMEM187 shRNA were electroporated into K562 cells using microporous membrane electroporation (MDMP E-1, Shanghai Mengde Bio, Shanghai, China), respectively. The electroporation conditions were set at LEVEL 5 and CYCLE 5. The cells were selected with 1 μg/mL puromycin for 7 days. Single clones were isolated for sequencing. The gRNA target sites are GCCCCCACTCTGGATTCATC and GGCCACGGCCACGTGCACGA. TMEM187 shRNA, sense 5′- ### Page 4 GTTCAACTCACTCGTGAACAT-3′, antisense 5′CAAGTTGAGTGAGCACTTGTA-3′. CD34+ cells were transfected with shRNA targeting TMEM187 using Lipo8000™ Transfection Reagent (Beyotime, Nanjing, China) according to the manufacturer’s instructions. Transfection was performed every 48 h for four times, and the cells were collected daily for analysis.Other cell culture and transfectionAll cell culture reagents used in the study were purchased from Sbjbio (Nanjing, China) unless otherwise stated. Cells were maintained at 37°C in an incubator with 5% CO2. K562, GM14519/50, and HEL cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, supplemented with 10% fetal bovine serum (FBS) and 1% P/S. HEK293, SGC7901, HeLa, HEK293T and A549 cells were cultured in high glucose Dulbecco’s Modified Eagle′s Medium (DMEM) with glutamine and sodium pyruvate, supplemented with 10% FBS and 1% P/S. RPMI 1640 medium without glutamine (Procell, Wuhan, China) was used to induce the erythroid-like differentiation of K562 cells. For cell transfection, Lipo8000™ Transfection Reagent (Beyotime) was used according to the supplier’s manual. Transfected plasmids included pCMV-HA- RAB11A, pCMV-HA-TMEM187, pCMV-3×FLAG, pCMV-3×FLAG-RAB11A, pEGFP-N1-TMEM187, pmcherry-N1-TMEM187, pEGFP-RAB11A-S25N, pEGFP- RAB11A-Q70L, pCDNA3.1(-)-GRAB-HA, pEGFP-N1 and pEGFP-TMEM187 (∆5/∆6/∆8/∆9/∆10). Cells were harvested 24 h post-transfection for further analysis.Hypoxia tolerance activitiesTo assess larvae's tolerance to hypoxia, 8- and 10-day post-fertilization larvae were collected. WT or tmem187-/- larvae (25/group) were placed in a 1.5 mL tube filled with fish water. Tubes were sealed with parafilm, and zebrafish larval survival rates were assessed and recorded after 4 h. Three independent experiments were performed.Immunological assaysFor immunoblotting, cells and mouse tissues were homogenized and lysed with cell lysis buffer (1% NP-40, 40 mM Tris, 4 M NaCl, with a protease inhibitor cocktail) ### Page 5 and RIPA lysis buffer (Beyotime), respectively. The protein concentration was determined using the Bradford method. Total protein (20-40 μg/lane) was loaded and separated in SDS-PAGE gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% nonfat milk and incubated with primary and secondary antibodies to detect proteins. Quantification of the band density was performed with ImageJ (http://rsb.info.nih.gov/ij/). Each experiment was repeated at least 3 times independently. For detailed information on primary and secondary antibodies, see supplemental Table 2 and 3, respectively. For co-immunoprecipitation, equal amounts of total protein were incubated with anti-HA magnetic beads (MedChemExpress, Monmouth Junction, NJ, USA), as previously reported1. For immunofluorescence assays, the procedure was the same as in the previous study2. Primary antibodies and Alexa Fluor 488/594-conjugated secondary antibodies are shown in supplemental Tables 2 and 3, respectively. The nuclei were counterstained with 4’,6‐diamidino‐2‐phenylindole (DAPI) (Servicebio, Wuhan, China). The stained cells were observed and photographed by confocal laser microscopy (Olympus FV3000, Tokyo, Japan). To evaluate nuclear condensation, the nuclear sizes of 60 randomly selected cells were measured using ImageJ software following DAPI staining.O-dianisidine stainingO-dianisidine staining was performed as described previously3. Embryos were collected at 48 hpf and 120 hpf. After anesthetizing, embryos were stained with o- dianisidine working solution [2 mL ddH2O, 0.5 mL 0.1 M sodium acetate (pH=4.5), 0.1 mL 30% H2O2, and 2 mL benzidine solution (100 mg o-dianisidine in 70 mL ethanol absolute)] for 15-90 minutes in dark at room temperature. After washing with ddH2O and fixing in 4% paraformaldehyde, the embryos were observed under a stereomicroscope. Cell staining was similar to that of zebrafish embryos. After staining, the slides were mounted for imaging.Heme stain in gelElectrophoresis was conducted on a native gel in the presence of SDS in the running buffer. A 4× LDS loading buffer was thoroughly mixed with 70 μg of protein ### Page 6 without heating to prevent protein denaturation. The electrophoresis was carried out at 200 V and 4°C until the loading buffer exited the gel. Subsequently, the gel was rinsed with distilled water and immediately incubated in a freshly prepared staining solution (7.5 mL TMBZ solution + 17.5 mL 0.25 M sodium acetate buffer) for 2 h in the dark. Following this, 125 μL of 30% H2O2 solution was added to maintain the reaction in the dark. Upon the appearance of distinct blue bands, the gel was photographed against a white background.Heme absorption spectroscopyUV-Visible absorption spectra of cell lysate were recorded between 260 and 650 nm on a spectrophotometer (SpectraMax M3, Molecular Devices, Shanghai, China). Equal amounts of total protein (1.5 mg) were used for the scans. Heme content was determined from the Soret absorption peak at 414 nm.Heme ELISA assaysHeme content in cells was measured according to the manufacturer’s protocols (cat# JN60832X, Jining Bio, Shanghai, China).Quantitative real-time PCR (qPCR) analysisTotal RNA was isolated with the RNA isolater Total RNA Extraction Reagent (Vazyme Biotech, Nanjing, China) and reversely transcribed into cDNA with the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech) according to the manufacturer’s instructions. PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech) on an Applied Biosystems 7300. The primers for qPCR are shown in supplemental Table 1. 18S rRNA was used as an internal control. Relative mRNA expression levels were calculated using the delta–delta CT method. The relative copy number of mtDNA was determined by comparing the copy number of mtDNA-locating CYTB to that of nDNA-locating ACTIN using isolated total DNA. The primers used are shown in supplemental Table 1.Flow cytometryFlow cytometry was performed on a FACS Calibur instrument according to the manufacturer’s protocol (BD Biosciences, San Jose, CA, USA). To analyze cell apoptosis, cells were stained with Annexin V-fluorescein isothiocyanate (FITC) and ### Page 7 propidium iodide (PI). To measure erythroid differentiation, cells were stained with anti-human CD71 and anti-human CD235a. To quantify erythroid cells in mouse bone marrow and spleen, cells were stained with anti-mouse Ter119. To quantify the frequency of erythroblast populations among Ter119+ cells in mouse bone marrow and spleen, cells were stained with anti-mouse Ter119 and anti-mouse CD44. Detailed information on the antibodies is provided in supplemental Table 2. All data were analyzed using FlowJo software.Electron microscopyCells were collected and fixed in 2% Paraformaldehyde with 0.1 M cacodylate buffer (Aladdin, Shanghai, China) at room temperature for 30 min, then kept at 4˚C. After rinsing the cells once or twice, the samples were dehydrated through a graded series of ethanol from 50% to 100%, then replaced with propylene oxide. The samples were kept in a 50% propylene oxide-50% Epon resin (1:1 mix) for 1 h, then in pure Epon. Next day, repeat above steps once with fresh Epon. Samples are transferred to fresh Epon in molds or Beem capsules (remove air bubbles) and left in the oven for at least 24 h at 60˚C. Samples were observed in a JEOL 1230 transmission electron microscope at 80 kV, and images were acquired with a Gatan Multiscan 791 digital camera.Genomic RNA sequencing (RNA-seq)K562 WT and TMEM187 KO cells were cultured with (uninduced) or without glutamine (induced) for 4 days. The cells were collected and resuspended in RNA isolater Total RNA Extraction Reagent. The samples were sent to the Majorbio Bio- Pharm Technology Co., Ltd. (Shanghai, China). The data were analyzed on the online Majorbio Cloud Platform. Differential genes were identified between groups using |log2FC|≥1 and P-adjust <0.05. The transcriptome data were submitted to NCBI (Accession number: PRJNA1304034).Phagocytosis assaysK562 WT and KO cells were stained with Hoechst 33342 (MedChemExpress) after a 7-day induction. After washing, pre-starved primary bone-marrow-derived macrophages (BMDMs) were co-incubated with Hoechst 33342-stained K562 WT or ### Page 8 KO cells to assess phagocytic capacity. After co-culture, the culture dish was thoroughly rinsed multiple times with 1×PBS to ensure the complete removal of all non-adherent or loosely attached cells under light microscopy observation. The remaining cells were imaged using confocal microscopy and counted within 1 mm² areas to determine the number of phagocytosed cells. The isolation and culture of BMDMs were performed as previously described4.Histological stainingFor Wright-Giemsa staining, peripheral blood smears were prepared by drawing blood from the retro-orbital sinus in mice or tail in zebrafish, then fixing the smears in methanol for 10 minutes and staining them with Wright-Giemsa stain (Servicebio) at room temperature, following the manufacturer's protocol. For Prussian blue staining, tissue sections were dealt with in the dewaxed and hydrated steps: dewaxed for 10 min in xylene twice; hydrated for 5 min in each 100%- 50% ethanol gradient buffers; rinsed for 5 min in running water at room temperature, and incubated in 1% potassium ferrocyanide in 0.12 M HCl for 30 min-4 h; for liver slides and bone marrow smears, before dehydrated through gradual ethyl alcohol solutions, sections were stained in Nuclear Fast Red Staining Solution (Servicebio) for 5-10 min. Images were viewed through a biological microscope (BX43, Olympus, Japan) and captured using a digital camera.Inductively coupled plasma-mass spectrometry (ICP-MS) assaysCells were collected (total cells≥107). The ICP-MS assays were performed by PANOMIX Biomedical Tech Co., Ltd (Suzhou, China).Ferrozine assaysThe ferrozine assays were performed to detect non-heme iron as previously described5. Briefly, 11 μL concentrated HCl (11.6 M) was added to 50 μL of 250 μg total protein. The samples were heated at 95°C for 20 min and centrifuged at the highest speed for 10 min. The 45 μL of supernatant was removed to a new tube. Then, 18 μL of ascorbate (75 mM), 18 μL of ferrozine (10 mM), and 36 μL of saturated ammonium acetate were sequentially added to each tube, and the mixture was incubated for 2 min ### Page 9 at room temperature between each addition. The absorbance was read at 570 nm (BioTek ELx800, Shanghai, China).Labile iron pool (LIP) measurementCytosolic LIP and mitochondrial LIP were measured using Calcein-AM (Aladdin) along with 2,2’-bipyridyl (BIP), and Rhodamine B-[(1,10-phenanthroline-5-yl)- aminocarbonyl] benzyl ester (RPA, Squarix GmbH, Elbestr, Germany) along with pyridoxal isonicotinoyl hydrazone (PIH) as previously described, respectively6.Enzymatic activity assaysIn-gel aconitase activity assays were performed as previously described1,7. Complex I and II activities were measured according to the manufacturer’s protocols (Comin Biotechnology Co., Suzhou, China). FECH activities were determined as described previously8.b-galactosidase activities were measured following the manufacturer’s protocols (Beyotime).Uptake of transferrinTransferrin uptake assays were performed as previously described9. Following the instruction manual, FITC-labeled holo-transferrin was prepared using purified holo- transferrin (Cat# ST1135, Beyotime) and FITC (Cat# 60514ES60, Yeasen). The stained cells were immediately observed and photographed by confocal laser microscopy (Olympus FV3000).Cell membrane fragility assaysSaline gradient solutions were prepared, 100 μL each, ranging from 0.1% to 0.8% with 0.05% intervals. K562 WT and TMEM187 KO cells after 7-day erythroid differentiation were harvested. The same cell numbers (1×105 cells) were aliquoted into each saline solution. Cell rupture was assessed after 4 h of incubation at room temperature to evaluate membrane fragility. Cell rupture was assessed by measuring lactate dehydrogenase (LDH) activity released into the medium, according to the manufacturer’s instructions (Beyotime). To assess erythrocyte membrane fragility in mice, saline gradient solutions were prepared at concentrations ranging from 0.3% to 0.7% in increments of 0.02%. ### Page 10 Peripheral blood was collected from both the control and cKI group mice via retro- orbital bleeding, and the same volume of blood cells was aliquoted into each salt solution. After incubating at room temperature for 1 hour, the color of the solution in each tube was evaluated to determine membrane fragility. ### Page 11 Supplemental tables Supplemental Table 1. Information on primers.Primers for genotypinggenotype Forward (5'-3') Reverse (5'-3')TMEM187Tg (loxp/loxp)CACTCACCCAAGATTCCATCCCTC CTTTATTAGCCAGAAGTCAGATGCVav-iCre CTCAGTGTAGGTGGAGAAAGACGAG CACACAGACAGGAGCATCTTCCAGtmem187-/- CCTTTCCTGCTTTGCATTGC GACTCCACCATTAAAGCATAGCPrimers for qRT-PCRgene names Forward (5'-3') Reverse (5'-3')HBA GACCTGCACGCGCACAAGCTT GCTCACAGAAGCCAGGAACTTGHBB AGTGATGGCCTGGCTCACCT AGCCACACCAGCCACCACTTHBG GGAAGATGCTGGAGGAGAAACC GTCAGCACCTTCTTGCCATGTGALAS2 GGATGTGTCCGTCTGGTGTA TACTGGTGCCTGAGAGTTGFECH TCAACCGCAGAAGAGGTATG ATGAGGTCTCGGTCCAAGAATMEM187 GCCGCCGGTTCCAGATGAAT CCTCGGCGTAGTGCTCATAG18S CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTGCYTB TATCCGCCATCCCATACATT GGTGATTCCTAGGGGGTTGTACTB AGAAAATCTGGCACCACACC AACGGCAGAAGAGAGAACCAtmem187 CCTTTCCTGCTTTGCATTGC ACTTTCTTCTCCGCGTAGTGgapdh CCAACTGCCTGGCTCCTT CCCATCAACGGTCTTCTGTG ### Page 12 Supplemental Table 2. Information on primary antibodies.Protein Names Dilution Ratio Vendors Cat No. PurposeTfR1 1:2000 Invitrogen (Waltham, MA, USA) 136800 WB, IF ALAS2 1:2000 Abcam (Cambridge, MA, USA) ab184964 WB Caspase 3 1:1000 ab179517 WB NCOA4 1:1000 ab86707 WB SDHB 1:2000 178423 WB HBB/HBG 1:500 Santa Cruz (Dallas, TX, USA) sc-22718 WB ACO2 1:2000 Proteintech Group Inc. (Chicago, IL, USA) 11134-1-AP WB Band 3/AE1 1:1000 28131-1-AP WB BAX 1:1000 50599-2-Ig WB BCL2 1:1000 12789-1-AP WB GAPDH 1:5000 60004-1-Ig WB GRAB 1:1000 17827-1-AP WB, IF HBA 1:1000 14537-1-AP WB NDUFS1 1:1000 12444-1-AP WB NFS1 1:1000 15370-1-AP WB NFU1 1:1000 25598-1-AP WB RAB11A 1:1000 15903-1-AP WB UQCRFS1 1:10000 1843-1-AP WB FTL 1:1000 Immunology Consultants Laboratory Inc. (Lake Oswego, OR, USA) RF-80A WB VDAC 1:2000 Cell Signaling Technology (Danvers, MA, USA) 4661 WB ACTB 1:10000 Bioworld (Nanjing, China) AP0060 WB ### Page 13 HA 1:1000 Covance (Princeton, New Jersey, USA) 14832901 WB, IP Myc 1:1000 Genscript (Nanjing, China) A00704 WB, IP eGFP 1:2000 Servicebio (Wuhan, China) GB11602 WB, IP CD71 1:200 eBioscience (San Diego, CA, USA) 17-9987-41 Flow cytometry CD235a 1:200 12-0719-41 Flow cytometry Ter119 1:200 47-5921-82 Flow cytometry CD44 1:200 12-0441-82 Flow cytometry FXN 1:1000 polyclonal, self-made7 WB ISCU 1:2000 polyclonal, self-made7 WB FECH 1:2000 polyclonal, self-made6 WB FTH 1:1000 polyclonal, self-made10 WB IRP1 1:1000 polyclonal, self-made6 WB IRP2 1:1000 polyclonal, self-made6 WB TMEM187 1:1000 polyclonal, self-made (supplemental Figure 13) WB ### Page 14 Supplemental Table 3. Information on secondary antibodies.Protein Names Dilution Ratio Vendors Cat No. Purposeanti-rabbit IgG (HRP) 1:50000 Jackson ImmunoResearch Laboratories (West Grove, PA, USA) 111-035-144 WB anti-mouse IgG (HRP) 1:50000 115-035-146 WB Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) 1:1000 111-545-003 IF Alexa Fluor 594-conjugated AffiniPure Goat Anti-Mouse IgG (H+L) 1:1000 115-585-003 IF Alexa Fluor 594-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) 1:1000 111-585-003 IF anti-goat IgG (HRP) 1:50000 Thermo Fisher Scientific (Waltham, MA, USA) 31402 WB ### Page 15 Supplemental figuresSupplemental Figure 1 Construction of TMEM187 knockout and knockdown K562 cells and comparison of their erythroid-differentiation ability. Erythroid differentiation was induced by glutamine deprivation. (A) TMEM187 knockout (KO) and knockdown (KD) strategies using CRISPR-Cas9 and shRNA, respectively. (B-C)Confirmation of TMEM187 knockout in K562 cells by detecting the protein and mRNA levels. GAPDH and 18S were used as internal controls, respectively. t-test was used for significance. n=3/group. ****P<0.0001. (D) Color of cell pellets prior to and post- induction for 4 days. (E) O-dianisidine staining of hemoglobin post-induction for 4 days. ### Page 16 Supplemental Figure 2 TMEM187 deficiency promotes erythropoiesis in K562 cells. (A) Quantification of the protein levels tested in Figure 2A. n=3/group. (B)Quantification of mRNA levels of FECH and ALAS2, detected by qPCR. 18S was used as an internal control. n=9/group. (C) Quantification of multiple forms of Band 3 for Figure 2F. n=3/group. One-way ANOVA was used for significance. *P<0.05,**P<0.01, ***P<0.001, ****P<0.0001. ### Page 17 Supplemental Figure 3 TMEM187 deletion comprehensively reprograms the gene expression profile for erythroid differentiation, revealed by RNA-seq. (A) The heatmap of the eight heme-biogenesis genes. TPM, transcript per million. (B) The enriched erythropoiesis-related pathways after induction, revealed by GO enrichment analysis. (C) Volcano plot of gene expression variation. The transcription factors (TFs) associated with erythropoiesis were indicated in K562 KO versus WT cells before induction. (D) Heatmap of erythropoiesis-relative TFs. ### Page 18 Supplemental Figure 4 TMEM187 deficiency has no impact on mitochondrial quantity and quality. (A) Representative fluorescence images of mitochondrial markers in K562 WT and KO cells. Mitotracker Green and red are mitochondrial membrane potential-independent and -dependent indicators, respectively. Blue: Hoechst 33342-indicated nucleus. The enlarged cells are indicated by white arrows. (B)Relative copy numbers of mitochondrial DNA in WT and KO cells. Nuclear DNA- encoded ACTIN was used as an internal control. t-test was used for significance. n=15/group. ns, no significance. (C) Electronic microscope images of the mitochondrial ultrastructure of K562 WT and KO cells. ### Page 19 Supplemental Figure 5 The quantification for Figure 4. The quantification for mean fluorescence intensity (MFI) of TfR1 (A), MFI of GRAB (B). n=50 cells in WT (uninduced) and KO (uninduced) group. n=15 cells in WT (induced) and KO (induced) group. (C) Quantification of the colocalization between GRAB and TfR1 in Figure 4A. Pearson's correlation coefficients are shown. n=4/group. (D) The quantification for internalized holo-Tf-FITC. n=25 cells in WT (uninduced) and KO (uninduced) group.n=11 cells in WT (induced) and KO (induced) group. One-way ANOVA was used for significance. *p<0.05, ***p<0.001, ****p<0.0001. ### Page 20 Supplemental Figure 6 Molecular docking and co-IP assays verify the interaction sites between TMEM187 and RAB11A and between GRAB and RAB11A. (A)Protein docking maps of RAB11A (blue) and GRAB (green). (B) Predicted interface residues between RAB11A and GRAB. (C-D) Protein docking of RAB11A (blue) and TMEM187 (orange). (E) The amino acid sequence of RAB11A and the predicted binding sites are labeled in green for GRAB and in yellow for TMEM187. (F)Construction of various truncated TMEM187-EGFP fragments. (G) Co-IP assays showing an interaction between HA-RAB11A and amino acids 188th to 208th of TMEM187 in HEK293 cells. Arrows indicated different truncated TMEM187-EGFP fragments. (H) K562 WT cells were supplemented with exogenous iron at increasing ### Page 21 concentrations ranging from 5 μM to 200 μM, during 4-day induction. K562 KO cells before and after 4-day induction were used for positive control. The erythroid differentiation and iron-related protein expression were detected by immunoblotting. GAPDH was used as an internal control. ### Page 22 Supplemental Figure 7 TMEM187 homologs and tmem187 gene knockout in Zebrafish. (A) Phylogenetic tree analysis of TMEM187. (B) Amino acid sequence alignment of human TMEM187 with zebrafish tmem187. (C) Sequencing results showing the deletion of tmem187 gene in zebrafish (tmem187-/- zebrafish with a deletion of ACTAC at positions 107-111 of the coding sequence). ### Page 23 Supplemental Figure 8 tmem187-/- zebrafish are more hypoxia intolerant than WT. (A) qPCR analyses of tmem187 mRNA levels in different developmental stages of zebrafish. Gapdh was used as an internal control. One-way ANOVA was used for significance. n=3/group. *P<0.05, **P<0.01. (B-C) Representative images of o- dianisidine staining at 120 hours post fertilization (hpf) in WT or tmem187-/- zebrafish in ventral view (B) and profile view (C). (D) Giemsa staining of WT and tmem187-/-zebrafish blood cells. (E-F) Representative pictures and survival statistics of 8 days ### Page 24 post fertilization (dpf) (E) and 10 dpf (F) zebrafish after 4-h hypoxic treatment. n=3x25/group. ### Page 25 Supplemental Figure 9 Blood routine tests of Control and cKI mice. Counts of (A)white blood cells (WBC), (B) lymphocytes (Lymph), (C) monocytes (Mon), (D)granulocytes (Gran), and (E) blood platelets (PLT) detected by blood routine tests. t- test was used for significance. n=4 for Control group; n=3 for cKI group. ns, no significance. ### Page 26 Supplemental Figure 10 Overexpression of TMEM187 in the hematopoietic system induces extramedullary erythropoiesis. (A) Representative images of spleens from Control and cKI mice. (B) Quantification of the spleen weight and the spleen-to- body weight ratio. (C-D) Percentage of Ter119+ erythroblasts from the spleen of the two genotype mice. (E-F) Frequency of erythroblast populations among Ter119+ cells in the spleen of the Control and cKI mice. t-test was used for significance. n=4 for Control group; n=3 for cKI group. ns, no significance, *P<0.05. ### Page 27 Supplemental Figure 11 The blood biochemical parameters. Indexes from blood biochemical parameters: (A) serum transferrin (TF), (B) serum iron, (C) unsaturated iron binding capacity (UIBC), (D) total iron binding capacity (TIBC), and (E)transferrin saturation (TS). t-test was used for significance. n=4 for Control group; n=3 for cKI group. ns, no significance, *P<0.05. ### Page 28 Supplemental Figure 12 cKI mice have reduced cell senescence and apoptosis in hematopoietic tissue, and TMEM187 expression is increased in patients with refractory anemia. (A) Representative images of erythrocyte membrane fragility assays in Control and cKI mice. (B) Expression of apoptosis-related proteins (Bcl2, Bax, Cleaved Casp3), detected by western blotting in Ter119+ cells derived from the bone marrow of the two genotype mice. (C) TMEM187 mRNA levels in CD34+ hematopoietic stem cells from myelodysplastic syndromes (MDS, old name as refractory anemia) with single- or multi-lineage dysplasia patients (n=73) and healthy controls (n=28). The data were collected from the GEO profile GSE19429 and the GDS2118 datasets. t-test was used for significance. *P<0.05. ### Page 29 Supplemental Figure 13 Validation of a self-made antibody against TMEM187.Evaluation of TMEM187 antibody with Western blotting in HEK293 cells transfected with pcDNA3.1-TMEM187-6×myc for 24 h. Immunoblotting anti-TMEM187 (A) and anti-Myc (B). * indicates the endogenous TMEM187 in HEK293 cells. Ponceau S stains were used as internal controls.References1. Zhao H, Lu Y, Zhang J, et al. NCOA4 requires a [3Fe-4S] to sense and maintain the iron homeostasis. J Biol Chem. Feb 2024;300(2):105612. doi:10.1016/j.jbc.2023.105612 2. Zhang W, Dong W, Cheng C, et al. Macrophages Internalize Epithelial-Derived Extracellular Vesicles That Contain Ferritin via the Macrophage Scavenger Receptor 1 to Promote Inflammatory Bowel Disease. J Extracell Vesicles. Jun 2025;14(6):e70105. doi:10.1002/jev2.70105 3. Rossmann MP, Hoi K, Chan V, et al. Cell-specific transcriptional control of mitochondrial metabolism by TIF1gamma drives erythropoiesis. Science. May 14 2021;372(6543):716-721. doi:10.1126/science.aaz2740 4. Xu T, Cai J, Wang L, et al. Hormone replacement therapy for postmenopausal atherosclerosis is offset by late age iron deposition. Elife. Aug 10 2023;12doi:10.7554/eLife.80494 5. Zhao H, Zhang M, Zhang J, et al. Hinokitiol-iron complex is a ferroptosis inducer to inhibit triple-negative breast tumor growth. Cell Biosci. May 13 2023;13(1):87. doi:10.1186/s13578-023-01044-0 6. Li H, Liu Y, Shang L, et al. Iron regulatory protein 2 modulates the switch from aerobic glycolysis to oxidative phosphorylation in mouse embryonic fibroblasts. Proc Natl Acad Sci U S A. May 14 2019;116(20):9871-9876. doi:10.1073/pnas.1820051116 ### Page 30 7. Zhao H, Li H, Hao S, et al. Peptide SS-31 upregulates frataxin expression and improves the quality of mitochondria: implications in the treatment of Friedreich ataxia.Sci Rep. Aug 29 2017;7(1):9840. doi:10.1038/s41598-017-10320-2 8. Palasuberniam P, Kraus D, Mansi M, et al. Ferrochelatase Deficiency Abrogated the Enhancement of Aminolevulinic Acid-mediated Protoporphyrin IX by Iron Chelator Deferoxamine. Photochem Photobiol. Jul 2019;95(4):1052-1059. doi:10.1111/php.13091 9. Chen M, Zhang Y, Jiang K, et al. Grab regulates transferrin receptor recycling and iron uptake in developing erythroblasts. Blood. Sep 8 2022;140(10):1145-1155. doi:10.1182/blood.2021015189 10. Liu Y, Li Y, Yang L, et al. Stimulation of Hepatic Ferritinophagy Mitigates Irp2 Depletion-Induced Anemia. Antioxidants (Basel). Feb 24 2023;12(3)doi:10.3390/antiox12030566